Review



e6150s celltrace cfse cell proliferation kit  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    New England Biolabs e6150s celltrace cfse cell proliferation kit
    E6150s Celltrace Cfse Cell Proliferation Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 997 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/e6150s+celltrace+cfse+cell+proliferation+kit/NEBNext+Magnesium+RNA+Fragmentation+Module/pmc06428223__NIHMS1523290___supplement___2-243-41-39
    Average 99 stars, based on 997 article reviews
    e6150s celltrace cfse cell proliferation kit - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Regulation of Intronic Polyadenylation by PCF11 Impacts mRNA Expression of Long Genes
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-PCF11 Santa Cruz Biotechnology Cat# sc-514158 Mouse anti-Myogenin Santa Cruz Biotechnology Cat# sc-12732; RRID: AB_627980 Mouse anti-GAPDH Santa Cruz Biotechnology Cat# sc-47724; RRID: AB_627678 Mouse anti-b-tubulin Developmental Studies Hybridoma Bank (DSHB) Cat# E7; RRID: AB_528499 m-IgGk BP-HRP Santa Cruz Biotechnology Cat# sc-516102; RRID: AB_2687626 Chemicals, Peptides, and Recombinant Proteins Phosphate buffered saline (PBS) Lab made N/A Dulbecco’s Modified Eagle Medium (DMEM) Lab made N/A RPMI-1640 Lab made N/A Bovine Calf Serum (CS) Sigma-Aldrich Cat# 12133C-500ML Fetal Bovine Serum (FBS) Atlanta biologicals Cat# S11550 Horse serum Sigma-Aldrich Cat# H1138-500ML Penicillin/Streptomycin GIBCO Cat# 15140-122 Lipofectamine 3000 Thermo Fisher Scientific Cat# L3000015 TRIzol Reagent Thermo Fisher Scientific Cat# 15596018 Oligo d(T)25 Magnetic Beads NEB Cat# S1419S Adenosine 50-Triphosphate (ATP) NEB Cat# P0756S SUPERased In RNase Inhibitor (20 U/mL) Thermo Fisher Scientific Cat# AM2694 NEBNext RNase III RNA Fragmentation Module NEB Cat# E6146 T4 RNA Ligase 1 NEB Cat# M0204S T4 RNA Ligase 2, truncated KQ NEB Cat# M0373S TURBO DNA-free Kit Thermo Fisher Scientific Cat# AM1907 M-MLV Reverse transcriptase Promega Cat# M1705 Phusion High-Fidelity DNA Polymerase NEB Cat# M0530S Q5 High-Fidelity DNA Polymerase NEB Cat# M0491S Dynabeads MyOne Streptavidin C1 Thermo Fisher Scientific Cat# 65001 RNase H Epicenter Cat# R52250 T4 Polynucleotide Kinase NEB Cat# M0201S Shrimp Alkaline Phosphatase (rSAP) NEB Cat# M0371S 50 adaptor: 50-CCUUGGCACCCGAGAAU UCCANNNN Sigma-Aldrich N/A DNA/LNA oligo: biotin-TTTTTTTTTTTTTTT+ TT+TT+TT+TT+TT, where ‘‘+T’’ denotes LNA Exiqon N/A 50 adenylated 30 blocked 30 adaptor with degenerated nucleotides: 50-rApp/NNNNGATCGTCGGACTGTA GAACTCTGAAC/3ddC Bioo Scientific N/A Reverse transcription primer: 50-GTTCAGA GTTCTACAGTCCGACGATC Sigma-Aldrich N/A Reverse PCR primer (GX3): 50-AATGATACGGCGACC ACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA Sigma-Aldrich N/A Indexed forward PCR primers (index region in bracket): 50-CAAGCAGAAGA CGGCATACGAGAT[NNNNNN] GTGACTGGAGTT CCTTGGCACCCGAGAATTCCA Sigma-Aldrich N/A AMPure XP beads Beckman Coulter Cat# A63881 (Continued on next page) Cell Reports 26, 2766–2778.e1–e6, March 5, 2019 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical Commercial Assays Agilent RNA 6000 Pico Kit Agilent Technologies Cat# 5067-1513 High Sensitivity DNA analysis kit Agilent Technologies Cat# 5067-4626 Luna Universal qPCR master mix NEB Cat# M3003 NEBNext Magnesium RNA Fragmentation Module NEB Cat# E6150S CellTrace CFSE Cell Proliferation Kit, for flow cytometry Thermo Fisher Scientific Cat# C34554 Deposited Data 30READS data This study GEO: GSE115232 RNA-seq data This study GEO: GSE115232 Experimental Models: Cell Lines Mouse: NIH 3T3 cells ATCC Cat# CRL-1658; RRID: CVCL_0594 Mouse: C2C12 cells ATCC Cat# CRL-1772; RRID: CVCL_0188 Mouse: 3T3-L1 cells ATCC Cat# CL-173; RRID: CVCL_0123 Mouse: 4T1-luc2-GFP Perkin Elmer Cat# 128090; RRID: CVCL_5J28 Mouse: 4T1-IPAPcf11-KO Generated in this study N/A Recombinant DNA Plasmid: PX459 Addgene Cat# 62988; RRID: Addgene_62988 Plasmid: PX459-mPcf11-IPA-g1 Cloned in this study N/A Plasmid: PX459-mPcf11-IPA-g2 Cloned in this study N/A Plasmid: pRiG Cloned and stored in lab N/A Plasmid: pRiG-AD Cloned and stored in lab N/A Plasmid: pRiG-Pcf11 Ctrl-seq Cloned in this study N/A Plasmid: pRiG- Pcf11 IPA site Cloned in this study N/A Plasmid: pRiG- Pcf11 pPAS Cloned in this study N/A Plasmid: pRiG- Pcf11 dPAS Cloned in this study N/A Oligonucleotides (See Tables S2 and S3) Software and Algorithms FIJI Schindelin et al., 2012 https://imagej.net/Fiji Primer-BLAST Ye et al., 2012 https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ Prism version 7.0a for Mac GraphPad Software N/A Cutadapt Martin, 2011 http://cutadapt.readthedocs.io/en/ stable/guide.html Bowtie2 Langmead and Salzberg, 2012 http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml DESeq & DEXSeq Anders and Huber, 2010 https://bioconductor.org/packages/ devel/bioc/html/DESeq.html STAR (v2.5.2) Dobin et al., 2013 https://github.com/alexdobin/STAR Scikit-learn Pedregosa et al., 2011 http://scikit-learn.org/stable/index.html MaxEntScan Yeo and Burge, 2004 http://genes.mit.edu/burgelab/maxent/ Xmaxentscan_scoreseq.html Other data sets KD of core CPA and splicing factors (30READS) Li et al., 2015 GEO: GSE11415 Transcriptional profiling of longitudinal changes during neurogenesis (RNA-seq) Hubbard et al., 2013 SRA: SRP017778 Genotype-Tissue Expression Project (GTEx) GTEx Consortium, 2017 dbGaP: phs000424.v7 Early stages of C2C12 differentiation (RNA-seq) Hamed et al., 2017 GEO: GSE94560 Pan-readthrough genes induced by stress (gene set) Vilborg et al., 2017 GEO: GSE98906 e2 Cell Reports 26, 2766–2778.e1–e6, March 5, 2019 ..

    Flow Cytometry:

    Article Title: Regulation of Intronic Polyadenylation by PCF11 Impacts mRNA Expression of Long Genes
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-PCF11 Santa Cruz Biotechnology Cat# sc-514158 Mouse anti-Myogenin Santa Cruz Biotechnology Cat# sc-12732; RRID: AB_627980 Mouse anti-GAPDH Santa Cruz Biotechnology Cat# sc-47724; RRID: AB_627678 Mouse anti-b-tubulin Developmental Studies Hybridoma Bank (DSHB) Cat# E7; RRID: AB_528499 m-IgGk BP-HRP Santa Cruz Biotechnology Cat# sc-516102; RRID: AB_2687626 Chemicals, Peptides, and Recombinant Proteins Phosphate buffered saline (PBS) Lab made N/A Dulbecco’s Modified Eagle Medium (DMEM) Lab made N/A RPMI-1640 Lab made N/A Bovine Calf Serum (CS) Sigma-Aldrich Cat# 12133C-500ML Fetal Bovine Serum (FBS) Atlanta biologicals Cat# S11550 Horse serum Sigma-Aldrich Cat# H1138-500ML Penicillin/Streptomycin GIBCO Cat# 15140-122 Lipofectamine 3000 Thermo Fisher Scientific Cat# L3000015 TRIzol Reagent Thermo Fisher Scientific Cat# 15596018 Oligo d(T)25 Magnetic Beads NEB Cat# S1419S Adenosine 50-Triphosphate (ATP) NEB Cat# P0756S SUPERased In RNase Inhibitor (20 U/mL) Thermo Fisher Scientific Cat# AM2694 NEBNext RNase III RNA Fragmentation Module NEB Cat# E6146 T4 RNA Ligase 1 NEB Cat# M0204S T4 RNA Ligase 2, truncated KQ NEB Cat# M0373S TURBO DNA-free Kit Thermo Fisher Scientific Cat# AM1907 M-MLV Reverse transcriptase Promega Cat# M1705 Phusion High-Fidelity DNA Polymerase NEB Cat# M0530S Q5 High-Fidelity DNA Polymerase NEB Cat# M0491S Dynabeads MyOne Streptavidin C1 Thermo Fisher Scientific Cat# 65001 RNase H Epicenter Cat# R52250 T4 Polynucleotide Kinase NEB Cat# M0201S Shrimp Alkaline Phosphatase (rSAP) NEB Cat# M0371S 50 adaptor: 50-CCUUGGCACCCGAGAAU UCCANNNN Sigma-Aldrich N/A DNA/LNA oligo: biotin-TTTTTTTTTTTTTTT+ TT+TT+TT+TT+TT, where ‘‘+T’’ denotes LNA Exiqon N/A 50 adenylated 30 blocked 30 adaptor with degenerated nucleotides: 50-rApp/NNNNGATCGTCGGACTGTA GAACTCTGAAC/3ddC Bioo Scientific N/A Reverse transcription primer: 50-GTTCAGA GTTCTACAGTCCGACGATC Sigma-Aldrich N/A Reverse PCR primer (GX3): 50-AATGATACGGCGACC ACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA Sigma-Aldrich N/A Indexed forward PCR primers (index region in bracket): 50-CAAGCAGAAGA CGGCATACGAGAT[NNNNNN] GTGACTGGAGTT CCTTGGCACCCGAGAATTCCA Sigma-Aldrich N/A AMPure XP beads Beckman Coulter Cat# A63881 (Continued on next page) Cell Reports 26, 2766–2778.e1–e6, March 5, 2019 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical Commercial Assays Agilent RNA 6000 Pico Kit Agilent Technologies Cat# 5067-1513 High Sensitivity DNA analysis kit Agilent Technologies Cat# 5067-4626 Luna Universal qPCR master mix NEB Cat# M3003 NEBNext Magnesium RNA Fragmentation Module NEB Cat# E6150S CellTrace CFSE Cell Proliferation Kit, for flow cytometry Thermo Fisher Scientific Cat# C34554 Deposited Data 30READS data This study GEO: GSE115232 RNA-seq data This study GEO: GSE115232 Experimental Models: Cell Lines Mouse: NIH 3T3 cells ATCC Cat# CRL-1658; RRID: CVCL_0594 Mouse: C2C12 cells ATCC Cat# CRL-1772; RRID: CVCL_0188 Mouse: 3T3-L1 cells ATCC Cat# CL-173; RRID: CVCL_0123 Mouse: 4T1-luc2-GFP Perkin Elmer Cat# 128090; RRID: CVCL_5J28 Mouse: 4T1-IPAPcf11-KO Generated in this study N/A Recombinant DNA Plasmid: PX459 Addgene Cat# 62988; RRID: Addgene_62988 Plasmid: PX459-mPcf11-IPA-g1 Cloned in this study N/A Plasmid: PX459-mPcf11-IPA-g2 Cloned in this study N/A Plasmid: pRiG Cloned and stored in lab N/A Plasmid: pRiG-AD Cloned and stored in lab N/A Plasmid: pRiG-Pcf11 Ctrl-seq Cloned in this study N/A Plasmid: pRiG- Pcf11 IPA site Cloned in this study N/A Plasmid: pRiG- Pcf11 pPAS Cloned in this study N/A Plasmid: pRiG- Pcf11 dPAS Cloned in this study N/A Oligonucleotides (See Tables S2 and S3) Software and Algorithms FIJI Schindelin et al., 2012 https://imagej.net/Fiji Primer-BLAST Ye et al., 2012 https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ Prism version 7.0a for Mac GraphPad Software N/A Cutadapt Martin, 2011 http://cutadapt.readthedocs.io/en/ stable/guide.html Bowtie2 Langmead and Salzberg, 2012 http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml DESeq & DEXSeq Anders and Huber, 2010 https://bioconductor.org/packages/ devel/bioc/html/DESeq.html STAR (v2.5.2) Dobin et al., 2013 https://github.com/alexdobin/STAR Scikit-learn Pedregosa et al., 2011 http://scikit-learn.org/stable/index.html MaxEntScan Yeo and Burge, 2004 http://genes.mit.edu/burgelab/maxent/ Xmaxentscan_scoreseq.html Other data sets KD of core CPA and splicing factors (30READS) Li et al., 2015 GEO: GSE11415 Transcriptional profiling of longitudinal changes during neurogenesis (RNA-seq) Hubbard et al., 2013 SRA: SRP017778 Genotype-Tissue Expression Project (GTEx) GTEx Consortium, 2017 dbGaP: phs000424.v7 Early stages of C2C12 differentiation (RNA-seq) Hamed et al., 2017 GEO: GSE94560 Pan-readthrough genes induced by stress (gene set) Vilborg et al., 2017 GEO: GSE98906 e2 Cell Reports 26, 2766–2778.e1–e6, March 5, 2019 ..

    RNA Sequencing:

    Article Title: Regulation of Intronic Polyadenylation by PCF11 Impacts mRNA Expression of Long Genes
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-PCF11 Santa Cruz Biotechnology Cat# sc-514158 Mouse anti-Myogenin Santa Cruz Biotechnology Cat# sc-12732; RRID: AB_627980 Mouse anti-GAPDH Santa Cruz Biotechnology Cat# sc-47724; RRID: AB_627678 Mouse anti-b-tubulin Developmental Studies Hybridoma Bank (DSHB) Cat# E7; RRID: AB_528499 m-IgGk BP-HRP Santa Cruz Biotechnology Cat# sc-516102; RRID: AB_2687626 Chemicals, Peptides, and Recombinant Proteins Phosphate buffered saline (PBS) Lab made N/A Dulbecco’s Modified Eagle Medium (DMEM) Lab made N/A RPMI-1640 Lab made N/A Bovine Calf Serum (CS) Sigma-Aldrich Cat# 12133C-500ML Fetal Bovine Serum (FBS) Atlanta biologicals Cat# S11550 Horse serum Sigma-Aldrich Cat# H1138-500ML Penicillin/Streptomycin GIBCO Cat# 15140-122 Lipofectamine 3000 Thermo Fisher Scientific Cat# L3000015 TRIzol Reagent Thermo Fisher Scientific Cat# 15596018 Oligo d(T)25 Magnetic Beads NEB Cat# S1419S Adenosine 50-Triphosphate (ATP) NEB Cat# P0756S SUPERased In RNase Inhibitor (20 U/mL) Thermo Fisher Scientific Cat# AM2694 NEBNext RNase III RNA Fragmentation Module NEB Cat# E6146 T4 RNA Ligase 1 NEB Cat# M0204S T4 RNA Ligase 2, truncated KQ NEB Cat# M0373S TURBO DNA-free Kit Thermo Fisher Scientific Cat# AM1907 M-MLV Reverse transcriptase Promega Cat# M1705 Phusion High-Fidelity DNA Polymerase NEB Cat# M0530S Q5 High-Fidelity DNA Polymerase NEB Cat# M0491S Dynabeads MyOne Streptavidin C1 Thermo Fisher Scientific Cat# 65001 RNase H Epicenter Cat# R52250 T4 Polynucleotide Kinase NEB Cat# M0201S Shrimp Alkaline Phosphatase (rSAP) NEB Cat# M0371S 50 adaptor: 50-CCUUGGCACCCGAGAAU UCCANNNN Sigma-Aldrich N/A DNA/LNA oligo: biotin-TTTTTTTTTTTTTTT+ TT+TT+TT+TT+TT, where ‘‘+T’’ denotes LNA Exiqon N/A 50 adenylated 30 blocked 30 adaptor with degenerated nucleotides: 50-rApp/NNNNGATCGTCGGACTGTA GAACTCTGAAC/3ddC Bioo Scientific N/A Reverse transcription primer: 50-GTTCAGA GTTCTACAGTCCGACGATC Sigma-Aldrich N/A Reverse PCR primer (GX3): 50-AATGATACGGCGACC ACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA Sigma-Aldrich N/A Indexed forward PCR primers (index region in bracket): 50-CAAGCAGAAGA CGGCATACGAGAT[NNNNNN] GTGACTGGAGTT CCTTGGCACCCGAGAATTCCA Sigma-Aldrich N/A AMPure XP beads Beckman Coulter Cat# A63881 (Continued on next page) Cell Reports 26, 2766–2778.e1–e6, March 5, 2019 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical Commercial Assays Agilent RNA 6000 Pico Kit Agilent Technologies Cat# 5067-1513 High Sensitivity DNA analysis kit Agilent Technologies Cat# 5067-4626 Luna Universal qPCR master mix NEB Cat# M3003 NEBNext Magnesium RNA Fragmentation Module NEB Cat# E6150S CellTrace CFSE Cell Proliferation Kit, for flow cytometry Thermo Fisher Scientific Cat# C34554 Deposited Data 30READS data This study GEO: GSE115232 RNA-seq data This study GEO: GSE115232 Experimental Models: Cell Lines Mouse: NIH 3T3 cells ATCC Cat# CRL-1658; RRID: CVCL_0594 Mouse: C2C12 cells ATCC Cat# CRL-1772; RRID: CVCL_0188 Mouse: 3T3-L1 cells ATCC Cat# CL-173; RRID: CVCL_0123 Mouse: 4T1-luc2-GFP Perkin Elmer Cat# 128090; RRID: CVCL_5J28 Mouse: 4T1-IPAPcf11-KO Generated in this study N/A Recombinant DNA Plasmid: PX459 Addgene Cat# 62988; RRID: Addgene_62988 Plasmid: PX459-mPcf11-IPA-g1 Cloned in this study N/A Plasmid: PX459-mPcf11-IPA-g2 Cloned in this study N/A Plasmid: pRiG Cloned and stored in lab N/A Plasmid: pRiG-AD Cloned and stored in lab N/A Plasmid: pRiG-Pcf11 Ctrl-seq Cloned in this study N/A Plasmid: pRiG- Pcf11 IPA site Cloned in this study N/A Plasmid: pRiG- Pcf11 pPAS Cloned in this study N/A Plasmid: pRiG- Pcf11 dPAS Cloned in this study N/A Oligonucleotides (See Tables S2 and S3) Software and Algorithms FIJI Schindelin et al., 2012 https://imagej.net/Fiji Primer-BLAST Ye et al., 2012 https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ Prism version 7.0a for Mac GraphPad Software N/A Cutadapt Martin, 2011 http://cutadapt.readthedocs.io/en/ stable/guide.html Bowtie2 Langmead and Salzberg, 2012 http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml DESeq & DEXSeq Anders and Huber, 2010 https://bioconductor.org/packages/ devel/bioc/html/DESeq.html STAR (v2.5.2) Dobin et al., 2013 https://github.com/alexdobin/STAR Scikit-learn Pedregosa et al., 2011 http://scikit-learn.org/stable/index.html MaxEntScan Yeo and Burge, 2004 http://genes.mit.edu/burgelab/maxent/ Xmaxentscan_scoreseq.html Other data sets KD of core CPA and splicing factors (30READS) Li et al., 2015 GEO: GSE11415 Transcriptional profiling of longitudinal changes during neurogenesis (RNA-seq) Hubbard et al., 2013 SRA: SRP017778 Genotype-Tissue Expression Project (GTEx) GTEx Consortium, 2017 dbGaP: phs000424.v7 Early stages of C2C12 differentiation (RNA-seq) Hamed et al., 2017 GEO: GSE94560 Pan-readthrough genes induced by stress (gene set) Vilborg et al., 2017 GEO: GSE98906 e2 Cell Reports 26, 2766–2778.e1–e6, March 5, 2019 ..

    Generated:

    Article Title: Regulation of Intronic Polyadenylation by PCF11 Impacts mRNA Expression of Long Genes
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-PCF11 Santa Cruz Biotechnology Cat# sc-514158 Mouse anti-Myogenin Santa Cruz Biotechnology Cat# sc-12732; RRID: AB_627980 Mouse anti-GAPDH Santa Cruz Biotechnology Cat# sc-47724; RRID: AB_627678 Mouse anti-b-tubulin Developmental Studies Hybridoma Bank (DSHB) Cat# E7; RRID: AB_528499 m-IgGk BP-HRP Santa Cruz Biotechnology Cat# sc-516102; RRID: AB_2687626 Chemicals, Peptides, and Recombinant Proteins Phosphate buffered saline (PBS) Lab made N/A Dulbecco’s Modified Eagle Medium (DMEM) Lab made N/A RPMI-1640 Lab made N/A Bovine Calf Serum (CS) Sigma-Aldrich Cat# 12133C-500ML Fetal Bovine Serum (FBS) Atlanta biologicals Cat# S11550 Horse serum Sigma-Aldrich Cat# H1138-500ML Penicillin/Streptomycin GIBCO Cat# 15140-122 Lipofectamine 3000 Thermo Fisher Scientific Cat# L3000015 TRIzol Reagent Thermo Fisher Scientific Cat# 15596018 Oligo d(T)25 Magnetic Beads NEB Cat# S1419S Adenosine 50-Triphosphate (ATP) NEB Cat# P0756S SUPERased In RNase Inhibitor (20 U/mL) Thermo Fisher Scientific Cat# AM2694 NEBNext RNase III RNA Fragmentation Module NEB Cat# E6146 T4 RNA Ligase 1 NEB Cat# M0204S T4 RNA Ligase 2, truncated KQ NEB Cat# M0373S TURBO DNA-free Kit Thermo Fisher Scientific Cat# AM1907 M-MLV Reverse transcriptase Promega Cat# M1705 Phusion High-Fidelity DNA Polymerase NEB Cat# M0530S Q5 High-Fidelity DNA Polymerase NEB Cat# M0491S Dynabeads MyOne Streptavidin C1 Thermo Fisher Scientific Cat# 65001 RNase H Epicenter Cat# R52250 T4 Polynucleotide Kinase NEB Cat# M0201S Shrimp Alkaline Phosphatase (rSAP) NEB Cat# M0371S 50 adaptor: 50-CCUUGGCACCCGAGAAU UCCANNNN Sigma-Aldrich N/A DNA/LNA oligo: biotin-TTTTTTTTTTTTTTT+ TT+TT+TT+TT+TT, where ‘‘+T’’ denotes LNA Exiqon N/A 50 adenylated 30 blocked 30 adaptor with degenerated nucleotides: 50-rApp/NNNNGATCGTCGGACTGTA GAACTCTGAAC/3ddC Bioo Scientific N/A Reverse transcription primer: 50-GTTCAGA GTTCTACAGTCCGACGATC Sigma-Aldrich N/A Reverse PCR primer (GX3): 50-AATGATACGGCGACC ACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA Sigma-Aldrich N/A Indexed forward PCR primers (index region in bracket): 50-CAAGCAGAAGA CGGCATACGAGAT[NNNNNN] GTGACTGGAGTT CCTTGGCACCCGAGAATTCCA Sigma-Aldrich N/A AMPure XP beads Beckman Coulter Cat# A63881 (Continued on next page) Cell Reports 26, 2766–2778.e1–e6, March 5, 2019 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical Commercial Assays Agilent RNA 6000 Pico Kit Agilent Technologies Cat# 5067-1513 High Sensitivity DNA analysis kit Agilent Technologies Cat# 5067-4626 Luna Universal qPCR master mix NEB Cat# M3003 NEBNext Magnesium RNA Fragmentation Module NEB Cat# E6150S CellTrace CFSE Cell Proliferation Kit, for flow cytometry Thermo Fisher Scientific Cat# C34554 Deposited Data 30READS data This study GEO: GSE115232 RNA-seq data This study GEO: GSE115232 Experimental Models: Cell Lines Mouse: NIH 3T3 cells ATCC Cat# CRL-1658; RRID: CVCL_0594 Mouse: C2C12 cells ATCC Cat# CRL-1772; RRID: CVCL_0188 Mouse: 3T3-L1 cells ATCC Cat# CL-173; RRID: CVCL_0123 Mouse: 4T1-luc2-GFP Perkin Elmer Cat# 128090; RRID: CVCL_5J28 Mouse: 4T1-IPAPcf11-KO Generated in this study N/A Recombinant DNA Plasmid: PX459 Addgene Cat# 62988; RRID: Addgene_62988 Plasmid: PX459-mPcf11-IPA-g1 Cloned in this study N/A Plasmid: PX459-mPcf11-IPA-g2 Cloned in this study N/A Plasmid: pRiG Cloned and stored in lab N/A Plasmid: pRiG-AD Cloned and stored in lab N/A Plasmid: pRiG-Pcf11 Ctrl-seq Cloned in this study N/A Plasmid: pRiG- Pcf11 IPA site Cloned in this study N/A Plasmid: pRiG- Pcf11 pPAS Cloned in this study N/A Plasmid: pRiG- Pcf11 dPAS Cloned in this study N/A Oligonucleotides (See Tables S2 and S3) Software and Algorithms FIJI Schindelin et al., 2012 https://imagej.net/Fiji Primer-BLAST Ye et al., 2012 https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ Prism version 7.0a for Mac GraphPad Software N/A Cutadapt Martin, 2011 http://cutadapt.readthedocs.io/en/ stable/guide.html Bowtie2 Langmead and Salzberg, 2012 http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml DESeq & DEXSeq Anders and Huber, 2010 https://bioconductor.org/packages/ devel/bioc/html/DESeq.html STAR (v2.5.2) Dobin et al., 2013 https://github.com/alexdobin/STAR Scikit-learn Pedregosa et al., 2011 http://scikit-learn.org/stable/index.html MaxEntScan Yeo and Burge, 2004 http://genes.mit.edu/burgelab/maxent/ Xmaxentscan_scoreseq.html Other data sets KD of core CPA and splicing factors (30READS) Li et al., 2015 GEO: GSE11415 Transcriptional profiling of longitudinal changes during neurogenesis (RNA-seq) Hubbard et al., 2013 SRA: SRP017778 Genotype-Tissue Expression Project (GTEx) GTEx Consortium, 2017 dbGaP: phs000424.v7 Early stages of C2C12 differentiation (RNA-seq) Hamed et al., 2017 GEO: GSE94560 Pan-readthrough genes induced by stress (gene set) Vilborg et al., 2017 GEO: GSE98906 e2 Cell Reports 26, 2766–2778.e1–e6, March 5, 2019 ..

    Recombinant:

    Article Title: Regulation of Intronic Polyadenylation by PCF11 Impacts mRNA Expression of Long Genes
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-PCF11 Santa Cruz Biotechnology Cat# sc-514158 Mouse anti-Myogenin Santa Cruz Biotechnology Cat# sc-12732; RRID: AB_627980 Mouse anti-GAPDH Santa Cruz Biotechnology Cat# sc-47724; RRID: AB_627678 Mouse anti-b-tubulin Developmental Studies Hybridoma Bank (DSHB) Cat# E7; RRID: AB_528499 m-IgGk BP-HRP Santa Cruz Biotechnology Cat# sc-516102; RRID: AB_2687626 Chemicals, Peptides, and Recombinant Proteins Phosphate buffered saline (PBS) Lab made N/A Dulbecco’s Modified Eagle Medium (DMEM) Lab made N/A RPMI-1640 Lab made N/A Bovine Calf Serum (CS) Sigma-Aldrich Cat# 12133C-500ML Fetal Bovine Serum (FBS) Atlanta biologicals Cat# S11550 Horse serum Sigma-Aldrich Cat# H1138-500ML Penicillin/Streptomycin GIBCO Cat# 15140-122 Lipofectamine 3000 Thermo Fisher Scientific Cat# L3000015 TRIzol Reagent Thermo Fisher Scientific Cat# 15596018 Oligo d(T)25 Magnetic Beads NEB Cat# S1419S Adenosine 50-Triphosphate (ATP) NEB Cat# P0756S SUPERased In RNase Inhibitor (20 U/mL) Thermo Fisher Scientific Cat# AM2694 NEBNext RNase III RNA Fragmentation Module NEB Cat# E6146 T4 RNA Ligase 1 NEB Cat# M0204S T4 RNA Ligase 2, truncated KQ NEB Cat# M0373S TURBO DNA-free Kit Thermo Fisher Scientific Cat# AM1907 M-MLV Reverse transcriptase Promega Cat# M1705 Phusion High-Fidelity DNA Polymerase NEB Cat# M0530S Q5 High-Fidelity DNA Polymerase NEB Cat# M0491S Dynabeads MyOne Streptavidin C1 Thermo Fisher Scientific Cat# 65001 RNase H Epicenter Cat# R52250 T4 Polynucleotide Kinase NEB Cat# M0201S Shrimp Alkaline Phosphatase (rSAP) NEB Cat# M0371S 50 adaptor: 50-CCUUGGCACCCGAGAAU UCCANNNN Sigma-Aldrich N/A DNA/LNA oligo: biotin-TTTTTTTTTTTTTTT+ TT+TT+TT+TT+TT, where ‘‘+T’’ denotes LNA Exiqon N/A 50 adenylated 30 blocked 30 adaptor with degenerated nucleotides: 50-rApp/NNNNGATCGTCGGACTGTA GAACTCTGAAC/3ddC Bioo Scientific N/A Reverse transcription primer: 50-GTTCAGA GTTCTACAGTCCGACGATC Sigma-Aldrich N/A Reverse PCR primer (GX3): 50-AATGATACGGCGACC ACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA Sigma-Aldrich N/A Indexed forward PCR primers (index region in bracket): 50-CAAGCAGAAGA CGGCATACGAGAT[NNNNNN] GTGACTGGAGTT CCTTGGCACCCGAGAATTCCA Sigma-Aldrich N/A AMPure XP beads Beckman Coulter Cat# A63881 (Continued on next page) Cell Reports 26, 2766–2778.e1–e6, March 5, 2019 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical Commercial Assays Agilent RNA 6000 Pico Kit Agilent Technologies Cat# 5067-1513 High Sensitivity DNA analysis kit Agilent Technologies Cat# 5067-4626 Luna Universal qPCR master mix NEB Cat# M3003 NEBNext Magnesium RNA Fragmentation Module NEB Cat# E6150S CellTrace CFSE Cell Proliferation Kit, for flow cytometry Thermo Fisher Scientific Cat# C34554 Deposited Data 30READS data This study GEO: GSE115232 RNA-seq data This study GEO: GSE115232 Experimental Models: Cell Lines Mouse: NIH 3T3 cells ATCC Cat# CRL-1658; RRID: CVCL_0594 Mouse: C2C12 cells ATCC Cat# CRL-1772; RRID: CVCL_0188 Mouse: 3T3-L1 cells ATCC Cat# CL-173; RRID: CVCL_0123 Mouse: 4T1-luc2-GFP Perkin Elmer Cat# 128090; RRID: CVCL_5J28 Mouse: 4T1-IPAPcf11-KO Generated in this study N/A Recombinant DNA Plasmid: PX459 Addgene Cat# 62988; RRID: Addgene_62988 Plasmid: PX459-mPcf11-IPA-g1 Cloned in this study N/A Plasmid: PX459-mPcf11-IPA-g2 Cloned in this study N/A Plasmid: pRiG Cloned and stored in lab N/A Plasmid: pRiG-AD Cloned and stored in lab N/A Plasmid: pRiG-Pcf11 Ctrl-seq Cloned in this study N/A Plasmid: pRiG- Pcf11 IPA site Cloned in this study N/A Plasmid: pRiG- Pcf11 pPAS Cloned in this study N/A Plasmid: pRiG- Pcf11 dPAS Cloned in this study N/A Oligonucleotides (See Tables S2 and S3) Software and Algorithms FIJI Schindelin et al., 2012 https://imagej.net/Fiji Primer-BLAST Ye et al., 2012 https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ Prism version 7.0a for Mac GraphPad Software N/A Cutadapt Martin, 2011 http://cutadapt.readthedocs.io/en/ stable/guide.html Bowtie2 Langmead and Salzberg, 2012 http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml DESeq & DEXSeq Anders and Huber, 2010 https://bioconductor.org/packages/ devel/bioc/html/DESeq.html STAR (v2.5.2) Dobin et al., 2013 https://github.com/alexdobin/STAR Scikit-learn Pedregosa et al., 2011 http://scikit-learn.org/stable/index.html MaxEntScan Yeo and Burge, 2004 http://genes.mit.edu/burgelab/maxent/ Xmaxentscan_scoreseq.html Other data sets KD of core CPA and splicing factors (30READS) Li et al., 2015 GEO: GSE11415 Transcriptional profiling of longitudinal changes during neurogenesis (RNA-seq) Hubbard et al., 2013 SRA: SRP017778 Genotype-Tissue Expression Project (GTEx) GTEx Consortium, 2017 dbGaP: phs000424.v7 Early stages of C2C12 differentiation (RNA-seq) Hamed et al., 2017 GEO: GSE94560 Pan-readthrough genes induced by stress (gene set) Vilborg et al., 2017 GEO: GSE98906 e2 Cell Reports 26, 2766–2778.e1–e6, March 5, 2019 ..

    Plasmid Preparation:

    Article Title: Regulation of Intronic Polyadenylation by PCF11 Impacts mRNA Expression of Long Genes
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-PCF11 Santa Cruz Biotechnology Cat# sc-514158 Mouse anti-Myogenin Santa Cruz Biotechnology Cat# sc-12732; RRID: AB_627980 Mouse anti-GAPDH Santa Cruz Biotechnology Cat# sc-47724; RRID: AB_627678 Mouse anti-b-tubulin Developmental Studies Hybridoma Bank (DSHB) Cat# E7; RRID: AB_528499 m-IgGk BP-HRP Santa Cruz Biotechnology Cat# sc-516102; RRID: AB_2687626 Chemicals, Peptides, and Recombinant Proteins Phosphate buffered saline (PBS) Lab made N/A Dulbecco’s Modified Eagle Medium (DMEM) Lab made N/A RPMI-1640 Lab made N/A Bovine Calf Serum (CS) Sigma-Aldrich Cat# 12133C-500ML Fetal Bovine Serum (FBS) Atlanta biologicals Cat# S11550 Horse serum Sigma-Aldrich Cat# H1138-500ML Penicillin/Streptomycin GIBCO Cat# 15140-122 Lipofectamine 3000 Thermo Fisher Scientific Cat# L3000015 TRIzol Reagent Thermo Fisher Scientific Cat# 15596018 Oligo d(T)25 Magnetic Beads NEB Cat# S1419S Adenosine 50-Triphosphate (ATP) NEB Cat# P0756S SUPERased In RNase Inhibitor (20 U/mL) Thermo Fisher Scientific Cat# AM2694 NEBNext RNase III RNA Fragmentation Module NEB Cat# E6146 T4 RNA Ligase 1 NEB Cat# M0204S T4 RNA Ligase 2, truncated KQ NEB Cat# M0373S TURBO DNA-free Kit Thermo Fisher Scientific Cat# AM1907 M-MLV Reverse transcriptase Promega Cat# M1705 Phusion High-Fidelity DNA Polymerase NEB Cat# M0530S Q5 High-Fidelity DNA Polymerase NEB Cat# M0491S Dynabeads MyOne Streptavidin C1 Thermo Fisher Scientific Cat# 65001 RNase H Epicenter Cat# R52250 T4 Polynucleotide Kinase NEB Cat# M0201S Shrimp Alkaline Phosphatase (rSAP) NEB Cat# M0371S 50 adaptor: 50-CCUUGGCACCCGAGAAU UCCANNNN Sigma-Aldrich N/A DNA/LNA oligo: biotin-TTTTTTTTTTTTTTT+ TT+TT+TT+TT+TT, where ‘‘+T’’ denotes LNA Exiqon N/A 50 adenylated 30 blocked 30 adaptor with degenerated nucleotides: 50-rApp/NNNNGATCGTCGGACTGTA GAACTCTGAAC/3ddC Bioo Scientific N/A Reverse transcription primer: 50-GTTCAGA GTTCTACAGTCCGACGATC Sigma-Aldrich N/A Reverse PCR primer (GX3): 50-AATGATACGGCGACC ACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA Sigma-Aldrich N/A Indexed forward PCR primers (index region in bracket): 50-CAAGCAGAAGA CGGCATACGAGAT[NNNNNN] GTGACTGGAGTT CCTTGGCACCCGAGAATTCCA Sigma-Aldrich N/A AMPure XP beads Beckman Coulter Cat# A63881 (Continued on next page) Cell Reports 26, 2766–2778.e1–e6, March 5, 2019 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical Commercial Assays Agilent RNA 6000 Pico Kit Agilent Technologies Cat# 5067-1513 High Sensitivity DNA analysis kit Agilent Technologies Cat# 5067-4626 Luna Universal qPCR master mix NEB Cat# M3003 NEBNext Magnesium RNA Fragmentation Module NEB Cat# E6150S CellTrace CFSE Cell Proliferation Kit, for flow cytometry Thermo Fisher Scientific Cat# C34554 Deposited Data 30READS data This study GEO: GSE115232 RNA-seq data This study GEO: GSE115232 Experimental Models: Cell Lines Mouse: NIH 3T3 cells ATCC Cat# CRL-1658; RRID: CVCL_0594 Mouse: C2C12 cells ATCC Cat# CRL-1772; RRID: CVCL_0188 Mouse: 3T3-L1 cells ATCC Cat# CL-173; RRID: CVCL_0123 Mouse: 4T1-luc2-GFP Perkin Elmer Cat# 128090; RRID: CVCL_5J28 Mouse: 4T1-IPAPcf11-KO Generated in this study N/A Recombinant DNA Plasmid: PX459 Addgene Cat# 62988; RRID: Addgene_62988 Plasmid: PX459-mPcf11-IPA-g1 Cloned in this study N/A Plasmid: PX459-mPcf11-IPA-g2 Cloned in this study N/A Plasmid: pRiG Cloned and stored in lab N/A Plasmid: pRiG-AD Cloned and stored in lab N/A Plasmid: pRiG-Pcf11 Ctrl-seq Cloned in this study N/A Plasmid: pRiG- Pcf11 IPA site Cloned in this study N/A Plasmid: pRiG- Pcf11 pPAS Cloned in this study N/A Plasmid: pRiG- Pcf11 dPAS Cloned in this study N/A Oligonucleotides (See Tables S2 and S3) Software and Algorithms FIJI Schindelin et al., 2012 https://imagej.net/Fiji Primer-BLAST Ye et al., 2012 https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ Prism version 7.0a for Mac GraphPad Software N/A Cutadapt Martin, 2011 http://cutadapt.readthedocs.io/en/ stable/guide.html Bowtie2 Langmead and Salzberg, 2012 http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml DESeq & DEXSeq Anders and Huber, 2010 https://bioconductor.org/packages/ devel/bioc/html/DESeq.html STAR (v2.5.2) Dobin et al., 2013 https://github.com/alexdobin/STAR Scikit-learn Pedregosa et al., 2011 http://scikit-learn.org/stable/index.html MaxEntScan Yeo and Burge, 2004 http://genes.mit.edu/burgelab/maxent/ Xmaxentscan_scoreseq.html Other data sets KD of core CPA and splicing factors (30READS) Li et al., 2015 GEO: GSE11415 Transcriptional profiling of longitudinal changes during neurogenesis (RNA-seq) Hubbard et al., 2013 SRA: SRP017778 Genotype-Tissue Expression Project (GTEx) GTEx Consortium, 2017 dbGaP: phs000424.v7 Early stages of C2C12 differentiation (RNA-seq) Hamed et al., 2017 GEO: GSE94560 Pan-readthrough genes induced by stress (gene set) Vilborg et al., 2017 GEO: GSE98906 e2 Cell Reports 26, 2766–2778.e1–e6, March 5, 2019 ..

    Clone Assay:

    Article Title: Regulation of Intronic Polyadenylation by PCF11 Impacts mRNA Expression of Long Genes
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-PCF11 Santa Cruz Biotechnology Cat# sc-514158 Mouse anti-Myogenin Santa Cruz Biotechnology Cat# sc-12732; RRID: AB_627980 Mouse anti-GAPDH Santa Cruz Biotechnology Cat# sc-47724; RRID: AB_627678 Mouse anti-b-tubulin Developmental Studies Hybridoma Bank (DSHB) Cat# E7; RRID: AB_528499 m-IgGk BP-HRP Santa Cruz Biotechnology Cat# sc-516102; RRID: AB_2687626 Chemicals, Peptides, and Recombinant Proteins Phosphate buffered saline (PBS) Lab made N/A Dulbecco’s Modified Eagle Medium (DMEM) Lab made N/A RPMI-1640 Lab made N/A Bovine Calf Serum (CS) Sigma-Aldrich Cat# 12133C-500ML Fetal Bovine Serum (FBS) Atlanta biologicals Cat# S11550 Horse serum Sigma-Aldrich Cat# H1138-500ML Penicillin/Streptomycin GIBCO Cat# 15140-122 Lipofectamine 3000 Thermo Fisher Scientific Cat# L3000015 TRIzol Reagent Thermo Fisher Scientific Cat# 15596018 Oligo d(T)25 Magnetic Beads NEB Cat# S1419S Adenosine 50-Triphosphate (ATP) NEB Cat# P0756S SUPERased In RNase Inhibitor (20 U/mL) Thermo Fisher Scientific Cat# AM2694 NEBNext RNase III RNA Fragmentation Module NEB Cat# E6146 T4 RNA Ligase 1 NEB Cat# M0204S T4 RNA Ligase 2, truncated KQ NEB Cat# M0373S TURBO DNA-free Kit Thermo Fisher Scientific Cat# AM1907 M-MLV Reverse transcriptase Promega Cat# M1705 Phusion High-Fidelity DNA Polymerase NEB Cat# M0530S Q5 High-Fidelity DNA Polymerase NEB Cat# M0491S Dynabeads MyOne Streptavidin C1 Thermo Fisher Scientific Cat# 65001 RNase H Epicenter Cat# R52250 T4 Polynucleotide Kinase NEB Cat# M0201S Shrimp Alkaline Phosphatase (rSAP) NEB Cat# M0371S 50 adaptor: 50-CCUUGGCACCCGAGAAU UCCANNNN Sigma-Aldrich N/A DNA/LNA oligo: biotin-TTTTTTTTTTTTTTT+ TT+TT+TT+TT+TT, where ‘‘+T’’ denotes LNA Exiqon N/A 50 adenylated 30 blocked 30 adaptor with degenerated nucleotides: 50-rApp/NNNNGATCGTCGGACTGTA GAACTCTGAAC/3ddC Bioo Scientific N/A Reverse transcription primer: 50-GTTCAGA GTTCTACAGTCCGACGATC Sigma-Aldrich N/A Reverse PCR primer (GX3): 50-AATGATACGGCGACC ACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA Sigma-Aldrich N/A Indexed forward PCR primers (index region in bracket): 50-CAAGCAGAAGA CGGCATACGAGAT[NNNNNN] GTGACTGGAGTT CCTTGGCACCCGAGAATTCCA Sigma-Aldrich N/A AMPure XP beads Beckman Coulter Cat# A63881 (Continued on next page) Cell Reports 26, 2766–2778.e1–e6, March 5, 2019 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical Commercial Assays Agilent RNA 6000 Pico Kit Agilent Technologies Cat# 5067-1513 High Sensitivity DNA analysis kit Agilent Technologies Cat# 5067-4626 Luna Universal qPCR master mix NEB Cat# M3003 NEBNext Magnesium RNA Fragmentation Module NEB Cat# E6150S CellTrace CFSE Cell Proliferation Kit, for flow cytometry Thermo Fisher Scientific Cat# C34554 Deposited Data 30READS data This study GEO: GSE115232 RNA-seq data This study GEO: GSE115232 Experimental Models: Cell Lines Mouse: NIH 3T3 cells ATCC Cat# CRL-1658; RRID: CVCL_0594 Mouse: C2C12 cells ATCC Cat# CRL-1772; RRID: CVCL_0188 Mouse: 3T3-L1 cells ATCC Cat# CL-173; RRID: CVCL_0123 Mouse: 4T1-luc2-GFP Perkin Elmer Cat# 128090; RRID: CVCL_5J28 Mouse: 4T1-IPAPcf11-KO Generated in this study N/A Recombinant DNA Plasmid: PX459 Addgene Cat# 62988; RRID: Addgene_62988 Plasmid: PX459-mPcf11-IPA-g1 Cloned in this study N/A Plasmid: PX459-mPcf11-IPA-g2 Cloned in this study N/A Plasmid: pRiG Cloned and stored in lab N/A Plasmid: pRiG-AD Cloned and stored in lab N/A Plasmid: pRiG-Pcf11 Ctrl-seq Cloned in this study N/A Plasmid: pRiG- Pcf11 IPA site Cloned in this study N/A Plasmid: pRiG- Pcf11 pPAS Cloned in this study N/A Plasmid: pRiG- Pcf11 dPAS Cloned in this study N/A Oligonucleotides (See Tables S2 and S3) Software and Algorithms FIJI Schindelin et al., 2012 https://imagej.net/Fiji Primer-BLAST Ye et al., 2012 https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ Prism version 7.0a for Mac GraphPad Software N/A Cutadapt Martin, 2011 http://cutadapt.readthedocs.io/en/ stable/guide.html Bowtie2 Langmead and Salzberg, 2012 http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml DESeq & DEXSeq Anders and Huber, 2010 https://bioconductor.org/packages/ devel/bioc/html/DESeq.html STAR (v2.5.2) Dobin et al., 2013 https://github.com/alexdobin/STAR Scikit-learn Pedregosa et al., 2011 http://scikit-learn.org/stable/index.html MaxEntScan Yeo and Burge, 2004 http://genes.mit.edu/burgelab/maxent/ Xmaxentscan_scoreseq.html Other data sets KD of core CPA and splicing factors (30READS) Li et al., 2015 GEO: GSE11415 Transcriptional profiling of longitudinal changes during neurogenesis (RNA-seq) Hubbard et al., 2013 SRA: SRP017778 Genotype-Tissue Expression Project (GTEx) GTEx Consortium, 2017 dbGaP: phs000424.v7 Early stages of C2C12 differentiation (RNA-seq) Hamed et al., 2017 GEO: GSE94560 Pan-readthrough genes induced by stress (gene set) Vilborg et al., 2017 GEO: GSE98906 e2 Cell Reports 26, 2766–2778.e1–e6, March 5, 2019 ..

    Indirect Immunoperoxidase Assay:

    Article Title: Regulation of Intronic Polyadenylation by PCF11 Impacts mRNA Expression of Long Genes
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-PCF11 Santa Cruz Biotechnology Cat# sc-514158 Mouse anti-Myogenin Santa Cruz Biotechnology Cat# sc-12732; RRID: AB_627980 Mouse anti-GAPDH Santa Cruz Biotechnology Cat# sc-47724; RRID: AB_627678 Mouse anti-b-tubulin Developmental Studies Hybridoma Bank (DSHB) Cat# E7; RRID: AB_528499 m-IgGk BP-HRP Santa Cruz Biotechnology Cat# sc-516102; RRID: AB_2687626 Chemicals, Peptides, and Recombinant Proteins Phosphate buffered saline (PBS) Lab made N/A Dulbecco’s Modified Eagle Medium (DMEM) Lab made N/A RPMI-1640 Lab made N/A Bovine Calf Serum (CS) Sigma-Aldrich Cat# 12133C-500ML Fetal Bovine Serum (FBS) Atlanta biologicals Cat# S11550 Horse serum Sigma-Aldrich Cat# H1138-500ML Penicillin/Streptomycin GIBCO Cat# 15140-122 Lipofectamine 3000 Thermo Fisher Scientific Cat# L3000015 TRIzol Reagent Thermo Fisher Scientific Cat# 15596018 Oligo d(T)25 Magnetic Beads NEB Cat# S1419S Adenosine 50-Triphosphate (ATP) NEB Cat# P0756S SUPERased In RNase Inhibitor (20 U/mL) Thermo Fisher Scientific Cat# AM2694 NEBNext RNase III RNA Fragmentation Module NEB Cat# E6146 T4 RNA Ligase 1 NEB Cat# M0204S T4 RNA Ligase 2, truncated KQ NEB Cat# M0373S TURBO DNA-free Kit Thermo Fisher Scientific Cat# AM1907 M-MLV Reverse transcriptase Promega Cat# M1705 Phusion High-Fidelity DNA Polymerase NEB Cat# M0530S Q5 High-Fidelity DNA Polymerase NEB Cat# M0491S Dynabeads MyOne Streptavidin C1 Thermo Fisher Scientific Cat# 65001 RNase H Epicenter Cat# R52250 T4 Polynucleotide Kinase NEB Cat# M0201S Shrimp Alkaline Phosphatase (rSAP) NEB Cat# M0371S 50 adaptor: 50-CCUUGGCACCCGAGAAU UCCANNNN Sigma-Aldrich N/A DNA/LNA oligo: biotin-TTTTTTTTTTTTTTT+ TT+TT+TT+TT+TT, where ‘‘+T’’ denotes LNA Exiqon N/A 50 adenylated 30 blocked 30 adaptor with degenerated nucleotides: 50-rApp/NNNNGATCGTCGGACTGTA GAACTCTGAAC/3ddC Bioo Scientific N/A Reverse transcription primer: 50-GTTCAGA GTTCTACAGTCCGACGATC Sigma-Aldrich N/A Reverse PCR primer (GX3): 50-AATGATACGGCGACC ACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA Sigma-Aldrich N/A Indexed forward PCR primers (index region in bracket): 50-CAAGCAGAAGA CGGCATACGAGAT[NNNNNN] GTGACTGGAGTT CCTTGGCACCCGAGAATTCCA Sigma-Aldrich N/A AMPure XP beads Beckman Coulter Cat# A63881 (Continued on next page) Cell Reports 26, 2766–2778.e1–e6, March 5, 2019 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical Commercial Assays Agilent RNA 6000 Pico Kit Agilent Technologies Cat# 5067-1513 High Sensitivity DNA analysis kit Agilent Technologies Cat# 5067-4626 Luna Universal qPCR master mix NEB Cat# M3003 NEBNext Magnesium RNA Fragmentation Module NEB Cat# E6150S CellTrace CFSE Cell Proliferation Kit, for flow cytometry Thermo Fisher Scientific Cat# C34554 Deposited Data 30READS data This study GEO: GSE115232 RNA-seq data This study GEO: GSE115232 Experimental Models: Cell Lines Mouse: NIH 3T3 cells ATCC Cat# CRL-1658; RRID: CVCL_0594 Mouse: C2C12 cells ATCC Cat# CRL-1772; RRID: CVCL_0188 Mouse: 3T3-L1 cells ATCC Cat# CL-173; RRID: CVCL_0123 Mouse: 4T1-luc2-GFP Perkin Elmer Cat# 128090; RRID: CVCL_5J28 Mouse: 4T1-IPAPcf11-KO Generated in this study N/A Recombinant DNA Plasmid: PX459 Addgene Cat# 62988; RRID: Addgene_62988 Plasmid: PX459-mPcf11-IPA-g1 Cloned in this study N/A Plasmid: PX459-mPcf11-IPA-g2 Cloned in this study N/A Plasmid: pRiG Cloned and stored in lab N/A Plasmid: pRiG-AD Cloned and stored in lab N/A Plasmid: pRiG-Pcf11 Ctrl-seq Cloned in this study N/A Plasmid: pRiG- Pcf11 IPA site Cloned in this study N/A Plasmid: pRiG- Pcf11 pPAS Cloned in this study N/A Plasmid: pRiG- Pcf11 dPAS Cloned in this study N/A Oligonucleotides (See Tables S2 and S3) Software and Algorithms FIJI Schindelin et al., 2012 https://imagej.net/Fiji Primer-BLAST Ye et al., 2012 https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ Prism version 7.0a for Mac GraphPad Software N/A Cutadapt Martin, 2011 http://cutadapt.readthedocs.io/en/ stable/guide.html Bowtie2 Langmead and Salzberg, 2012 http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml DESeq & DEXSeq Anders and Huber, 2010 https://bioconductor.org/packages/ devel/bioc/html/DESeq.html STAR (v2.5.2) Dobin et al., 2013 https://github.com/alexdobin/STAR Scikit-learn Pedregosa et al., 2011 http://scikit-learn.org/stable/index.html MaxEntScan Yeo and Burge, 2004 http://genes.mit.edu/burgelab/maxent/ Xmaxentscan_scoreseq.html Other data sets KD of core CPA and splicing factors (30READS) Li et al., 2015 GEO: GSE11415 Transcriptional profiling of longitudinal changes during neurogenesis (RNA-seq) Hubbard et al., 2013 SRA: SRP017778 Genotype-Tissue Expression Project (GTEx) GTEx Consortium, 2017 dbGaP: phs000424.v7 Early stages of C2C12 differentiation (RNA-seq) Hamed et al., 2017 GEO: GSE94560 Pan-readthrough genes induced by stress (gene set) Vilborg et al., 2017 GEO: GSE98906 e2 Cell Reports 26, 2766–2778.e1–e6, March 5, 2019 ..

    Software:

    Article Title: Regulation of Intronic Polyadenylation by PCF11 Impacts mRNA Expression of Long Genes
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-PCF11 Santa Cruz Biotechnology Cat# sc-514158 Mouse anti-Myogenin Santa Cruz Biotechnology Cat# sc-12732; RRID: AB_627980 Mouse anti-GAPDH Santa Cruz Biotechnology Cat# sc-47724; RRID: AB_627678 Mouse anti-b-tubulin Developmental Studies Hybridoma Bank (DSHB) Cat# E7; RRID: AB_528499 m-IgGk BP-HRP Santa Cruz Biotechnology Cat# sc-516102; RRID: AB_2687626 Chemicals, Peptides, and Recombinant Proteins Phosphate buffered saline (PBS) Lab made N/A Dulbecco’s Modified Eagle Medium (DMEM) Lab made N/A RPMI-1640 Lab made N/A Bovine Calf Serum (CS) Sigma-Aldrich Cat# 12133C-500ML Fetal Bovine Serum (FBS) Atlanta biologicals Cat# S11550 Horse serum Sigma-Aldrich Cat# H1138-500ML Penicillin/Streptomycin GIBCO Cat# 15140-122 Lipofectamine 3000 Thermo Fisher Scientific Cat# L3000015 TRIzol Reagent Thermo Fisher Scientific Cat# 15596018 Oligo d(T)25 Magnetic Beads NEB Cat# S1419S Adenosine 50-Triphosphate (ATP) NEB Cat# P0756S SUPERased In RNase Inhibitor (20 U/mL) Thermo Fisher Scientific Cat# AM2694 NEBNext RNase III RNA Fragmentation Module NEB Cat# E6146 T4 RNA Ligase 1 NEB Cat# M0204S T4 RNA Ligase 2, truncated KQ NEB Cat# M0373S TURBO DNA-free Kit Thermo Fisher Scientific Cat# AM1907 M-MLV Reverse transcriptase Promega Cat# M1705 Phusion High-Fidelity DNA Polymerase NEB Cat# M0530S Q5 High-Fidelity DNA Polymerase NEB Cat# M0491S Dynabeads MyOne Streptavidin C1 Thermo Fisher Scientific Cat# 65001 RNase H Epicenter Cat# R52250 T4 Polynucleotide Kinase NEB Cat# M0201S Shrimp Alkaline Phosphatase (rSAP) NEB Cat# M0371S 50 adaptor: 50-CCUUGGCACCCGAGAAU UCCANNNN Sigma-Aldrich N/A DNA/LNA oligo: biotin-TTTTTTTTTTTTTTT+ TT+TT+TT+TT+TT, where ‘‘+T’’ denotes LNA Exiqon N/A 50 adenylated 30 blocked 30 adaptor with degenerated nucleotides: 50-rApp/NNNNGATCGTCGGACTGTA GAACTCTGAAC/3ddC Bioo Scientific N/A Reverse transcription primer: 50-GTTCAGA GTTCTACAGTCCGACGATC Sigma-Aldrich N/A Reverse PCR primer (GX3): 50-AATGATACGGCGACC ACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA Sigma-Aldrich N/A Indexed forward PCR primers (index region in bracket): 50-CAAGCAGAAGA CGGCATACGAGAT[NNNNNN] GTGACTGGAGTT CCTTGGCACCCGAGAATTCCA Sigma-Aldrich N/A AMPure XP beads Beckman Coulter Cat# A63881 (Continued on next page) Cell Reports 26, 2766–2778.e1–e6, March 5, 2019 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical Commercial Assays Agilent RNA 6000 Pico Kit Agilent Technologies Cat# 5067-1513 High Sensitivity DNA analysis kit Agilent Technologies Cat# 5067-4626 Luna Universal qPCR master mix NEB Cat# M3003 NEBNext Magnesium RNA Fragmentation Module NEB Cat# E6150S CellTrace CFSE Cell Proliferation Kit, for flow cytometry Thermo Fisher Scientific Cat# C34554 Deposited Data 30READS data This study GEO: GSE115232 RNA-seq data This study GEO: GSE115232 Experimental Models: Cell Lines Mouse: NIH 3T3 cells ATCC Cat# CRL-1658; RRID: CVCL_0594 Mouse: C2C12 cells ATCC Cat# CRL-1772; RRID: CVCL_0188 Mouse: 3T3-L1 cells ATCC Cat# CL-173; RRID: CVCL_0123 Mouse: 4T1-luc2-GFP Perkin Elmer Cat# 128090; RRID: CVCL_5J28 Mouse: 4T1-IPAPcf11-KO Generated in this study N/A Recombinant DNA Plasmid: PX459 Addgene Cat# 62988; RRID: Addgene_62988 Plasmid: PX459-mPcf11-IPA-g1 Cloned in this study N/A Plasmid: PX459-mPcf11-IPA-g2 Cloned in this study N/A Plasmid: pRiG Cloned and stored in lab N/A Plasmid: pRiG-AD Cloned and stored in lab N/A Plasmid: pRiG-Pcf11 Ctrl-seq Cloned in this study N/A Plasmid: pRiG- Pcf11 IPA site Cloned in this study N/A Plasmid: pRiG- Pcf11 pPAS Cloned in this study N/A Plasmid: pRiG- Pcf11 dPAS Cloned in this study N/A Oligonucleotides (See Tables S2 and S3) Software and Algorithms FIJI Schindelin et al., 2012 https://imagej.net/Fiji Primer-BLAST Ye et al., 2012 https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ Prism version 7.0a for Mac GraphPad Software N/A Cutadapt Martin, 2011 http://cutadapt.readthedocs.io/en/ stable/guide.html Bowtie2 Langmead and Salzberg, 2012 http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml DESeq & DEXSeq Anders and Huber, 2010 https://bioconductor.org/packages/ devel/bioc/html/DESeq.html STAR (v2.5.2) Dobin et al., 2013 https://github.com/alexdobin/STAR Scikit-learn Pedregosa et al., 2011 http://scikit-learn.org/stable/index.html MaxEntScan Yeo and Burge, 2004 http://genes.mit.edu/burgelab/maxent/ Xmaxentscan_scoreseq.html Other data sets KD of core CPA and splicing factors (30READS) Li et al., 2015 GEO: GSE11415 Transcriptional profiling of longitudinal changes during neurogenesis (RNA-seq) Hubbard et al., 2013 SRA: SRP017778 Genotype-Tissue Expression Project (GTEx) GTEx Consortium, 2017 dbGaP: phs000424.v7 Early stages of C2C12 differentiation (RNA-seq) Hamed et al., 2017 GEO: GSE94560 Pan-readthrough genes induced by stress (gene set) Vilborg et al., 2017 GEO: GSE98906 e2 Cell Reports 26, 2766–2778.e1–e6, March 5, 2019 ..

    Expressing:

    Article Title: Regulation of Intronic Polyadenylation by PCF11 Impacts mRNA Expression of Long Genes
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-PCF11 Santa Cruz Biotechnology Cat# sc-514158 Mouse anti-Myogenin Santa Cruz Biotechnology Cat# sc-12732; RRID: AB_627980 Mouse anti-GAPDH Santa Cruz Biotechnology Cat# sc-47724; RRID: AB_627678 Mouse anti-b-tubulin Developmental Studies Hybridoma Bank (DSHB) Cat# E7; RRID: AB_528499 m-IgGk BP-HRP Santa Cruz Biotechnology Cat# sc-516102; RRID: AB_2687626 Chemicals, Peptides, and Recombinant Proteins Phosphate buffered saline (PBS) Lab made N/A Dulbecco’s Modified Eagle Medium (DMEM) Lab made N/A RPMI-1640 Lab made N/A Bovine Calf Serum (CS) Sigma-Aldrich Cat# 12133C-500ML Fetal Bovine Serum (FBS) Atlanta biologicals Cat# S11550 Horse serum Sigma-Aldrich Cat# H1138-500ML Penicillin/Streptomycin GIBCO Cat# 15140-122 Lipofectamine 3000 Thermo Fisher Scientific Cat# L3000015 TRIzol Reagent Thermo Fisher Scientific Cat# 15596018 Oligo d(T)25 Magnetic Beads NEB Cat# S1419S Adenosine 50-Triphosphate (ATP) NEB Cat# P0756S SUPERased In RNase Inhibitor (20 U/mL) Thermo Fisher Scientific Cat# AM2694 NEBNext RNase III RNA Fragmentation Module NEB Cat# E6146 T4 RNA Ligase 1 NEB Cat# M0204S T4 RNA Ligase 2, truncated KQ NEB Cat# M0373S TURBO DNA-free Kit Thermo Fisher Scientific Cat# AM1907 M-MLV Reverse transcriptase Promega Cat# M1705 Phusion High-Fidelity DNA Polymerase NEB Cat# M0530S Q5 High-Fidelity DNA Polymerase NEB Cat# M0491S Dynabeads MyOne Streptavidin C1 Thermo Fisher Scientific Cat# 65001 RNase H Epicenter Cat# R52250 T4 Polynucleotide Kinase NEB Cat# M0201S Shrimp Alkaline Phosphatase (rSAP) NEB Cat# M0371S 50 adaptor: 50-CCUUGGCACCCGAGAAU UCCANNNN Sigma-Aldrich N/A DNA/LNA oligo: biotin-TTTTTTTTTTTTTTT+ TT+TT+TT+TT+TT, where ‘‘+T’’ denotes LNA Exiqon N/A 50 adenylated 30 blocked 30 adaptor with degenerated nucleotides: 50-rApp/NNNNGATCGTCGGACTGTA GAACTCTGAAC/3ddC Bioo Scientific N/A Reverse transcription primer: 50-GTTCAGA GTTCTACAGTCCGACGATC Sigma-Aldrich N/A Reverse PCR primer (GX3): 50-AATGATACGGCGACC ACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA Sigma-Aldrich N/A Indexed forward PCR primers (index region in bracket): 50-CAAGCAGAAGA CGGCATACGAGAT[NNNNNN] GTGACTGGAGTT CCTTGGCACCCGAGAATTCCA Sigma-Aldrich N/A AMPure XP beads Beckman Coulter Cat# A63881 (Continued on next page) Cell Reports 26, 2766–2778.e1–e6, March 5, 2019 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical Commercial Assays Agilent RNA 6000 Pico Kit Agilent Technologies Cat# 5067-1513 High Sensitivity DNA analysis kit Agilent Technologies Cat# 5067-4626 Luna Universal qPCR master mix NEB Cat# M3003 NEBNext Magnesium RNA Fragmentation Module NEB Cat# E6150S CellTrace CFSE Cell Proliferation Kit, for flow cytometry Thermo Fisher Scientific Cat# C34554 Deposited Data 30READS data This study GEO: GSE115232 RNA-seq data This study GEO: GSE115232 Experimental Models: Cell Lines Mouse: NIH 3T3 cells ATCC Cat# CRL-1658; RRID: CVCL_0594 Mouse: C2C12 cells ATCC Cat# CRL-1772; RRID: CVCL_0188 Mouse: 3T3-L1 cells ATCC Cat# CL-173; RRID: CVCL_0123 Mouse: 4T1-luc2-GFP Perkin Elmer Cat# 128090; RRID: CVCL_5J28 Mouse: 4T1-IPAPcf11-KO Generated in this study N/A Recombinant DNA Plasmid: PX459 Addgene Cat# 62988; RRID: Addgene_62988 Plasmid: PX459-mPcf11-IPA-g1 Cloned in this study N/A Plasmid: PX459-mPcf11-IPA-g2 Cloned in this study N/A Plasmid: pRiG Cloned and stored in lab N/A Plasmid: pRiG-AD Cloned and stored in lab N/A Plasmid: pRiG-Pcf11 Ctrl-seq Cloned in this study N/A Plasmid: pRiG- Pcf11 IPA site Cloned in this study N/A Plasmid: pRiG- Pcf11 pPAS Cloned in this study N/A Plasmid: pRiG- Pcf11 dPAS Cloned in this study N/A Oligonucleotides (See Tables S2 and S3) Software and Algorithms FIJI Schindelin et al., 2012 https://imagej.net/Fiji Primer-BLAST Ye et al., 2012 https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ Prism version 7.0a for Mac GraphPad Software N/A Cutadapt Martin, 2011 http://cutadapt.readthedocs.io/en/ stable/guide.html Bowtie2 Langmead and Salzberg, 2012 http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml DESeq & DEXSeq Anders and Huber, 2010 https://bioconductor.org/packages/ devel/bioc/html/DESeq.html STAR (v2.5.2) Dobin et al., 2013 https://github.com/alexdobin/STAR Scikit-learn Pedregosa et al., 2011 http://scikit-learn.org/stable/index.html MaxEntScan Yeo and Burge, 2004 http://genes.mit.edu/burgelab/maxent/ Xmaxentscan_scoreseq.html Other data sets KD of core CPA and splicing factors (30READS) Li et al., 2015 GEO: GSE11415 Transcriptional profiling of longitudinal changes during neurogenesis (RNA-seq) Hubbard et al., 2013 SRA: SRP017778 Genotype-Tissue Expression Project (GTEx) GTEx Consortium, 2017 dbGaP: phs000424.v7 Early stages of C2C12 differentiation (RNA-seq) Hamed et al., 2017 GEO: GSE94560 Pan-readthrough genes induced by stress (gene set) Vilborg et al., 2017 GEO: GSE98906 e2 Cell Reports 26, 2766–2778.e1–e6, March 5, 2019 ..



    Similar Products

    e6150s celltrace cfse cell proliferation kit  (New England Biolabs)
    99
    New England Biolabs e6150s celltrace cfse cell proliferation kit
    E6150s Celltrace Cfse Cell Proliferation Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/e6150s+celltrace+cfse+cell+proliferation+kit/NEBNext+Magnesium+RNA+Fragmentation+Module/pmc06428223__NIHMS1523290___supplement___2-243-41-39
    Average 99 stars, based on 1 article reviews
    e6150s celltrace cfse cell proliferation kit - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier

    Image Search Results